Open source biology

Joe Schloendorn is creating and distributing plasmids that can freely be reproduced — a huge breakthrough for DIY bio.

Photo by mira66 on Flickr, used under a Creative Commons license.

At O’Reilly, we’ve long been supporters of the open source movement — perhaps not with the religious fervor of some, but with a deep appreciation for how open source has transformed the computing industry over the last three decades.

We also have a deep appreciation for the dangers that closed source, restrictive licenses, patent trolling, and other technocratic evils pose to areas that are just opening up — biology, in particular. So it is with great interest that I read Open Source Biotech Consumables in the latest issue of BioCoder.

I’m not going to rehash the article; you should read it yourself. The basic argument is that some proteins used in research cost thousands of dollars per milligram. They’re easily reproducible (we’re talking DNA, after all), but frequently tied up with restrictive licenses. In addition, many of the vendors will only sell to research institutions and large corporations, not home labs or small community labs. So, Joe Schloendorn is creating and distributing plasmids that can freely be reproduced. That in itself is a huge breakthrough.

His article started me wondering about the meaning of open source in biology — specifically, open source DNA. I grew up with the computer industry, and I understand open source source code. I can download a tarball of C (or clone a GitHub archive), look at what’s there, modify it, use the results. At some level, DNA is no different: I’ve said that synthetic biology is programming in a language we don’t yet understand; there is no “DNA: The Definitive Guide.” So, the superficial implementation of open source for DNA would be a long string of AATCGGGGGCCCCCAAAGAATGGC (what did I just say?), with an Apache License attached somewhere. Or GPL, or MIT; pick your flavor — we’re not religious about it.

Insert the plasmids into some bacteria and brew up a batch of new DNA — it’s simpler and faster than brewing beer.

While that might be where we’re headed, such an implementation isn’t useful. I think there are a few labs that can synthesize DNA from a list of nucleotides, but that’s a route that most small labs and home experimenters can’t take.

What Schloendorn is doing is much more interesting: he’s distributing the plasmids containing the gene of interest, and saying that you’re free to reproduce it. Insert the plasmids into some bacteria and brew up a batch of new DNA. It’s simple — simpler and faster than brewing beer.

Where is the source code? In many respects, the source code is the DNA itself, not the series of ATCGs that represent it. That’s what we need to reproduce and modify, even if we don’t know or understand it as well as we understand a tarball of C, Python, or Java.

But I still wonder: what does an “open source” license mean for this kind of source code? What’s the best way to protect DNA from patent trolling and other abuses? Having been involved with the computer industry all my life, code that you can’t see makes me nervous. Shipping plasmids sounds, to me, like proprietary software you can download for free: “free as in beer,” not “free as in liberty.” But this clearly isn’t about “free as in beer”; you are free to reproduce and modify the DNA.

That’s a discussion that we need to have, and I’m thrilled that we’re starting to have it.

The Summer 2014 issue of BioCoder is now available for free download.

Image on container, category, and content pages by mira66 on Flickr, used under a Creative Commons license.

tags: , ,
  • http://redmonk.com/dberkholz Donnie Berkholz

    Big difference in cost between “DNA, after all” and purified protein. That’s a multistep process requiring expensive reagents, equipment, and typically human involvement. You’ve gotta get the DNA into cells, grow them, isolate them, break them, isolate all protein, then specifically isolate your protein of interest (typically a complex protocol in its own right). This gets vastly more difficult when you’re talking about things like membrane proteins. If that investment in finding a good protocol doesn’t get paid back by customers, then it doesn’t make sense to the business.

  • John Schloendorn

    Donnie,
    well, those who are doing this work routinely will understand that the “expensive reagents” used for protein purification are essentially different dilutions of salt water… To name just one example, pOpenTaq allows anyone with moderate biotech experience to make millions of units of chromatographically pure, DNA-free, DNAse-free Taq Polymerase, while consuming only electricity, water and some grams of salt (following the freely available detailed protocol on my site — no figuring things out is needed).

    Equipment, well you don’t really need anything you don’t have in your kitchen for Taq Pol, DNA ladders… For other proteins yes you do need chromatography, and even for Taq it’s better to have it. Bootstrapping equipment still requires more creativity, but I’d encourage interested folks to check around the web. Chromatography equipment is basically a pump and a detector. Nothing that can’t be jury-rigged with some motivation.

    Labor (and again with pOpenTaq) — at current market prices for the enzyme, the labor term in fact becomes negligible at a culture size of about 10ml (not a typo) — if that seems counter intuitive, just do the math! It takes 1 full day of work to do and 1 to characterize, pretty much irrespective of how large you make the culture. The idea is of course to change that. I’d love a world where enough people figure this out to compete against each other to bring the cost of these things in line with the price, and labor does become the limiting factor. And you are right, it doesn’t make business sense to release them. It only makes sense to use them once your competitor does ;-)

    Of course, this isn’t for everyone. If you can get other people’s money to do your biotech, by all means keep doing that while it lasts. Your pay will largely depend on how much you raise and spend, and everyone can dance while the music is playing. I made a choice to… withdraw from that business model. I’m trying to help folks who don’t have any other people’s money, because my view is that’s where certain innovations are going to come from that I would like to happen.

    • mod guy

      I REALLY think this is very exciting and I applaud you for doing this. Certainly, there will be missteps with bio open source, but I believe making plasmids available to a number of bio-hackers will certainly speed things up in this rapidly developing field. :)

  • nitika rose

    Today as the
    online shopping grows in popularity more people are turning to online shopping
    for all their needs. Online delivery of best wishes along with this gifts and
    flowers for your loving mother on Mother’s Day. Send Mother’s Day Gifts to Malaysia which is filled with your good
    wishes.